| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072136 |
| Chromosome: | chromosome 14 |
| Location: | 1739748 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g619133 | SDH1 | Succinate dehydrogenase flavoprotein subunit; (1 of 1) K00234 - succinate dehydrogenase (ubiquinone) flavoprotein subunit (SDHA, SDH1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCCGCAAATGATGCTGCCGGCGTCACGGGGTGCTGGTGGCCGCCGCTG |
| Internal bar code: | GTTGTTGTAGTTCGCAAGGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 678 |
| LEAP-Seq percent confirming: | 14.2857 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCACCTCGCTCTTTTGCAT |
| Suggested primer 2: | TCCTGCGAGGGGATTTAGGA |