| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072152 |
| Chromosome: | chromosome 1 |
| Location: | 3188539 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g020305 | SDH4 | Succinate dehydrogenase subunit D; (1 of 1) IPR007992 - Succinate dehydrogenase [ubiquinone]cytochrome b small subunit, CybS | intron |
| Cre01.g802251 | (1 of 2) PF05328 - CybS, succinate dehydrogenase cytochrome B small subunit (CybS) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAAAGCTGTGAACTGTAAAGCGACGGGTAGACACGAAGGCACGGCAAG |
| Internal bar code: | ACCGAGGGGTCCCATTCCGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2229 |
| LEAP-Seq percent confirming: | 31.5789 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACGTCACCACTGACATGCC |
| Suggested primer 2: | TATCATGAGGGCACGTACGC |