| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.072165 |
| Chromosome: | chromosome 6 |
| Location: | 1456259 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260200 | MITC18,MCP18 | (1 of 1) K15100 - solute carrier family 25 (mitochondrial citrate transporter), member 1 (SLC25A1, CTP); Mitochondrial substrate carrier protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAGAAACACCATCGTACCTTGTCCCTAACGTCCTACGCCGCGGCCCCA |
| Internal bar code: | CCATCAGGCAGGTCAGCTAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1365 |
| LEAP-Seq percent confirming: | 97.6744 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTGCAGTGAGAAGGTGA |
| Suggested primer 2: | CCATTTGGCCGGTAGACCTT |