Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.072184 |
Chromosome: | chromosome 9 |
Location: | 5820719 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g411450 | DAP1,DNAAF2,Ktu,MOT45,PF13,PRR1 | (1 of 3) PF08190 - pre-RNA processing PIH1/Nop17 (PIH1); Dynein Assembly factor PIH domain 1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACAAAGACTTGCTCATTAGTTTCACAACTACAAGGAAGCTCTGTTGCG |
Internal bar code: | TGCAGGAGTCATCGTTTAGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 545 |
LEAP-Seq percent confirming: | 45.977 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 47 |
LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCATCTCCTGCAGCAGTT |
Suggested primer 2: | TGCTACGCCCAATAACAGCA |