Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.072209 |
Chromosome: | chromosome 9 |
Location: | 6422473 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g414900 | ELG33,ELG41,ELG32 | (1 of 2) PTHR11062//PTHR11062:SF89 - EXOSTOSIN HEPARAN SULFATE GLYCOSYLTRANSFERASE -RELATED // SUBFAMILY NOT NAMED; Exostosin-like glycosyltransferase 41 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCAGTCACACCATCGTGACCCAGCCCACCCCGTGTTTAACTCTCTTT |
Internal bar code: | ATAGAGATATTTTGGTGTAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3562 |
LEAP-Seq percent confirming: | 45.0 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCTGTTCTGTGAGTGCGGT |
Suggested primer 2: | TACGGGACCGATGATGCAAG |