| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072240 |
| Chromosome: | chromosome 10 |
| Location: | 6416209 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464550 | LAT1 | (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr); Latrunculin-B sensitive 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGGCCGAGCCACGCGGGCGGACCCACAGCCTGCGCGGCGGCACACAA |
| Internal bar code: | GGTTTAGCTTCTCGATGGGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 702 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCCTGTTGCTGGCGAT |
| Suggested primer 2: | GGATGTGGGTGGGAAAGGAG |