| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072270 |
| Chromosome: | chromosome 16 |
| Location: | 1976923 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g656433 | TNP41,CSB59 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon); {"Probable transposon-derived protein of Chlamydomonas-Specific family B | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGAGCTTGTGTCTCCACCATCAAAGCCTAGGAAGACAGTCTTGGCCGC |
| Internal bar code: | TGTTATCGCGAAGCAAATTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 756 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTTGCAGACTTTGACCGA |
| Suggested primer 2: | GTTCGGCCTCAGACTGTGAA |