Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.072280 |
Chromosome: | chromosome 16 |
Location: | 1234598 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650950 | (1 of 1) PF01931 - Protein of unknown function DUF84 (NTPase_I-T) | 5'UTR | |
Cre16.g651000 | RFA3,RPA70B | (1 of 1) PTHR23273:SF4 - REPLICATION PROTEIN A 70 KDA DNA-BINDING SUBUNIT; Replication protein A, 70 kDa DNA-binding subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTATCATCTTGGCGCCAAAGTGCATCTCAGCGAATCTTGCTGTCAAGCGC |
Internal bar code: | GCTGTGAACATAGGGGGTATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2405 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGAACACCAGCTTGCTTTG |
Suggested primer 2: | TGTCGATTGCTGCTGAAGGT |