| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072284 |
| Chromosome: | chromosome 12 |
| Location: | 3385388 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498050 | CPS3 | Putative subunit of mRNA cleavage and polyadenylation specificity factor; (1 of 1) K14403 - cleavage and polyadenylation specificity factor subunit 3 (CPSF3, YSH1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCATGACCCGCACCGCCCGCACCCCGCCACCAAGCCCCGCCGGGGC |
| Internal bar code: | GGCCTGGGGAGCGTATCCTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 630 |
| LEAP-Seq percent confirming: | 69.2308 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGAAACGGTGCAAACAGC |
| Suggested primer 2: | GTCGTTGAGTGACTCCACGT |