| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.072304 |
| Chromosome: | chromosome 5 |
| Location: | 1559392 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234666 | (1 of 6) 2.7.7.84 - 2'-5' oligoadenylate synthase | 3'UTR | |
| Cre05.g800535 | (1 of 25) IPR001965//IPR011011//IPR013083//IPR019787 - Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, PHD-finger | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTGAGAGTCTGATCAACTCCTACGACGGGAATAGCGACATCTCCGGCC |
| Internal bar code: | GACCAAACGTTGTGTCAAACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1235 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATTTTCTCGGGCGCTTGA |
| Suggested primer 2: | CGGTTGTCGGGTGAGGTTTA |