Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.072308 |
Chromosome: | chromosome 6 |
Location: | 3076776 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g275100 | Nucleolin; (1 of 1) K11294 - nucleolin (NCL, NSR1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGTCCGCGCAGCACGCGGCGCTCAGCCAACGGAAGCCGTCTTCAGCA |
Internal bar code: | TGTAATTGCTGTGTAAGGCTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2336 |
LEAP-Seq percent confirming: | 91.1765 |
LEAP-Seq n confirming: | 31 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGATGGAGGCGATTGTGAT |
Suggested primer 2: | TCTCGCTAATGACGGGATGC |