Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.072320 |
Chromosome: | chromosome 16 |
Location: | 4435197 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g668150 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype | 3'UTR | |
Cre16.g668200 | ING? | (1 of 1) PF00628//PF12998 - PHD-finger (PHD) // Inhibitor of growth proteins N-terminal histone-binding (ING); PHD-type zinc-finger protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGTTACAGATGCAGTGGCCGCAGTGCGCGTCATCAGTCATGCCAGTA |
Internal bar code: | AAACTCCATAGTCATGGCAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4130 |
LEAP-Seq percent confirming: | 20.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCAAGTCGGGCAAGAAGA |
Suggested primer 2: | CCGGTCATCCTTGTGTGTGA |