Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.072344 |
Chromosome: | chromosome 7 |
Location: | 1326775 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g322450 | HLM13 | putative N-methyltransferase; (1 of 1) PF00855//PF00856 - PWWP domain (PWWP) // SET domain (SET) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAACACGTCCACTCCAGTTCTGCAAATGCACCACATTGCCTCCACCCC |
Internal bar code: | TTAGTAATTACATACAGAAGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1466 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCGCTAATGCACATGTACG |
Suggested primer 2: | CGAAACCTGCGTGGCATATG |