| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072365 |
| Chromosome: | chromosome 5 |
| Location: | 2442656 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238800 | (1 of 6) 3.6.4.1 - Myosin ATPase / Actomyosin | 3'UTR | |
| Cre05.g238850 | PHC17 | Putative pherophorin-chlamydomonas homolog | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCTGTACAGAACTGCAACGATCTGTAACAGTCCCACACTCCCACCCA |
| Internal bar code: | TTACAAGCCGTACCACTTGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2623 |
| LEAP-Seq percent confirming: | 77.3585 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTGGTCAGGCAACCTTGT |
| Suggested primer 2: | GGCAGGCCTGTACCCATATC |