| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072376 |
| Chromosome: | chromosome 14 |
| Location: | 1992015 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620850 | NSG17 | (1 of 9) PF00010 - Helix-loop-helix DNA-binding domain (HLH); Basic helix-loop-helix transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTGAGCATATTGTACTAGTGTGAGTGCACAGCATGAAACCCGCGCCAT |
| Internal bar code: | GTTGATGATGGGTGCTTTCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2683 |
| LEAP-Seq percent confirming: | 58.9744 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGCCGTTAAGAATCGTG |
| Suggested primer 2: | CCTCCGAAACCGGCTCTATC |