| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072392 |
| Chromosome: | chromosome 3 |
| Location: | 4783494 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g177900 | TOB38,SAM38,TOM37,MTX1 | Metaxin 1; (1 of 1) K17776 - metaxin (MTX) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGCCCAGCCTCCTTTCTCTCTCGCCGGTAAACGCCTGGTCCGAATG |
| Internal bar code: | TCAGGAGTTGAAAGGCATAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 672 |
| LEAP-Seq percent confirming: | 97.6744 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGGAGTGTGTTGGTTTGG |
| Suggested primer 2: | CATCAAATTGGTGCGGGTGG |