| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072395 |
| Chromosome: | plastome |
| Location: | 169414 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802325 | rps12,ChreCp060,2717036 | (1 of 2) IPR005679 - Ribosomal protein S12, bacteria; 30S ribosomal protein S12 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACGGGACGCCAGTGGACGTCCCCTTCGGGATTTTAATGCAATAAATAA |
| Internal bar code: | GGAGTATTAAGTGACACAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 339 |
| LEAP-Seq percent confirming: | 46.4286 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGAGTTAGTAGCGGTACC |
| Suggested primer 2: | CCAGGTGTTGGCCACAATTT |