Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.072420 |
Chromosome: | plastome |
Location: | 60300 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802288 | rps7,2716973,ChreCp024 | 30S ribosomal protein S7; (1 of 2) K02992 - small subunit ribosomal protein S7 (RP-S7, MRPS7, rpsG) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGTTTACATACTCCGAAGTTTACTTGCCCGAAGGGGAAGGAGGAAGC |
Internal bar code: | GAATTACTGCTATGCGAGGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 55 |
LEAP-Seq percent confirming: | 90.0 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTTACCGCGCTTAAAGGCT |
Suggested primer 2: | TTGCCATTGCTAACGCCATG |