Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.072422 |
Chromosome: | chromosome 8 |
Location: | 3849863 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g381650 | (1 of 1) PTHR12265//PTHR12265:SF0 - UNCHARACTERIZED // TRANSMEMBRANE PROTEIN 53 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTCCAACCCCAGCCCACACCATCCATCACCCGCCAACTTGGGCGTGC |
Internal bar code: | ATTTAAAAAAACGTCACTTAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 320 |
LEAP-Seq percent confirming: | 42.8571 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTTGGGGCTGATCTGTCA |
Suggested primer 2: | CCCCCTCTTACTGTTGCTGG |