| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072452 |
| Chromosome: | chromosome 6 |
| Location: | 4915045 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280900 | VTI2,GOS1 | (1 of 1) K08495 - golgi SNAP receptor complex member 1 (GOSR1, GOS1); Intra-Golgi Qb-SNARE, Gos1/Gos28-family (Qb.II) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATATGATCGCGTGCTGGAGCATGCCGGTGCAGAATGTGTTTGCCCTCA |
| Internal bar code: | CAGATGGACCGGTTTGTAAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3063 |
| LEAP-Seq percent confirming: | 79.1667 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTGGAAGTCGCTGATCT |
| Suggested primer 2: | GTATCCCCCTCACCTGGTCT |