| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072456 |
| Chromosome: | chromosome 12 |
| Location: | 3975757 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515650 | EIF3K | Eukaryotic translation initiation factor 3, subunit K; (1 of 1) K15028 - translation initiation factor 3 subunit K (EIF3K) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCACTGCTGCAGGTCGCGAACCGCTCATGGAGCCTGGATGCTAATGT |
| Internal bar code: | CCCCCGGCTCAAACGTATCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 105 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGCCTCTGATTCCGCAT |
| Suggested primer 2: | GCGCGCTATGCAAGAAATCA |