| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072464 |
| Chromosome: | chromosome 1 |
| Location: | 7384718 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g051900 | ISP1,RIP1 | (1 of 1) K00411 - ubiquinol-cytochrome c reductase iron-sulfur subunit (UQCRFS1, RIP1, petA); Rieske iron-sulfur protein of mitochondrial ubiquinol-cytochrome c reductase | 5'UTR |
| Cre01.g800134 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCCACTCTCAGGGGACAGAAGTTTTGCGATGGACCCATTCAGCGATT |
| Internal bar code: | GCAGCTGATGTGTGTGAGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3053 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 84 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGCCCGTACACAAGGAGG |
| Suggested primer 2: | CTTGAAGACCTCCACGGCAT |