| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072477 |
| Chromosome: | chromosome 17 |
| Location: | 5785734 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741200 | EB1,EBP1 | (1 of 1) K10436 - microtubule-associated protein, RP/EB family (MAPRE); Microtubule plus-end binding protein EB1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTGAGGCATGTGCTGCTGCTGTGAGGCGCCCTTTGCCTCACCTTGT |
| Internal bar code: | GCATCGGTAGGGGCAATACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 436 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCTGGTGTCTCAAGGGTG |
| Suggested primer 2: | CACCCGGTCCTTGAAGTACC |