| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072492 |
| Chromosome: | chromosome 1 |
| Location: | 251379 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g001600 | Predicted protein containing BTB/POZ fold domain (involved in protein binding); (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCACAACCCACCATGATGCATGTGTGCTAATACACTGGTGCCGTACC |
| Internal bar code: | CAATGGACATAAATTTGTGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5070 |
| LEAP-Seq percent confirming: | 98.7013 |
| LEAP-Seq n confirming: | 76 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAAGGGCTGGTACGTGG |
| Suggested primer 2: | GAGGTGTGTGTACGTGTCGT |