Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.072501 |
Chromosome: | chromosome 3 |
Location: | 3651698 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g168450 | CCT8 | (1 of 1) K09500 - T-complex protein 1 subunit theta (CCT8); T-complex protein 1, theta subunit | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGGATTGGTACGCTACGTCTATCACTACACGACTTACCTCATACACGC |
Internal bar code: | ACAATCACATAACAAACACCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1567 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 32 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTGCAAGGAATGGTTGTG |
Suggested primer 2: | CAATCGAAGCCATGCAGAGC |