| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072511 |
| Chromosome: | chromosome 7 |
| Location: | 5215369 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g349100 | HEL39 | ATP-dependent RNA helicase; (1 of 1) K12813 - pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 (DHX16) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGAATGAATCAAGCCGCCTCCACCCTGGGTTGGGTTCGGTTTAATTT |
| Internal bar code: | TATATCGTGACGACTATAGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 52 |
| LEAP-Seq percent confirming: | 5.88235 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTGCTCCAGCCACCAAAC |
| Suggested primer 2: | CGTCCTTATGTCTCCTGCCC |