| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072525 |
| Chromosome: | chromosome 1 |
| Location: | 7855449 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g055412 | 5'UTR | ||
| Cre01.g055416 | (1 of 1) K12859 - U5 snRNP protein, DIM1 family (TXNL4A, DIB1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTCCAGGAGTGGAGACTGAAGCTCTGCAATCACTCAATCAGCTGTCC |
| Internal bar code: | GATCCTAACCGAGGATACTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 459 |
| LEAP-Seq percent confirming: | 70.2703 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGCAATATCCCGCTAGTT |
| Suggested primer 2: | GGATTCAGGGAGATCGCAGG |