| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072539 |
| Chromosome: | chromosome 1 |
| Location: | 8155176 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g068377 | (1 of 1) K14771 - U3 small nucleolar RNA-associated protein 19 (NOC4, UTP19) | 3'UTR | |
| Cre01.g068742 | (1 of 4) PF01424 - R3H domain (R3H) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAATAGCGAACAAGCCCGAGCGACCGGATGAGGGCCCACAGAGCGACCG |
| Internal bar code: | CCAATAGTATCCTTTTTTGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2597 |
| LEAP-Seq percent confirming: | 36.3636 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAGGACACGTGTAACCGG |
| Suggested primer 2: | CCGTAGTATTGACCGACCCG |