| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.072597 |
| Chromosome: | chromosome 6 |
| Location: | 1642838 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g261950 | ANK11 | (1 of 29) PF13637 - Ankyrin repeats (many copies) (Ank_4); Predicted protein with ankyrin repeats | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTGCCTCGACAGCTGGAAGACTGCTGGGGGCTGGACGCGGAAGGTTGT |
| Internal bar code: | TGGGTGAAACAAAGGTCAATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 843 |
| LEAP-Seq percent confirming: | 43.2432 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGTGCATACCTGAAAGCA |
| Suggested primer 2: | CTACGTCCCGATGTACTGGC |