Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.072600 |
Chromosome: | chromosome 3 |
Location: | 1671889 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g153000 | 3'UTR | ||
Cre03.g153050 | RWP1 | (1 of 1) IPR000104//IPR003035 - Antifreeze protein, type I // RWP-RK domain; RWP-RK transcription factor | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCTGCCTCACCATCACACTGCTGTCATGCCAGCGGGTGAGCGGGACGA |
Internal bar code: | TTGTGACATAAACGCGTCGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2050 |
LEAP-Seq percent confirming: | 53.3333 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATCAGGGGCGTGAGGTATG |
Suggested primer 2: | AGGAGACGATGAAAAGGCCG |