| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072622 |
| Chromosome: | chromosome 10 |
| Location: | 5291164 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456480 | (1 of 39) PTHR13078:SF53 - PROTEIN MAOC-1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCTTGGCACGCGCTTGCCCGAATCCTGCTGGCGGCAGCCTTTTGGGG |
| Internal bar code: | GGCACTCTGGCCCGCTGAACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2584 |
| LEAP-Seq percent confirming: | 17.8571 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGTTTGCGGCTGACTAC |
| Suggested primer 2: | TAACCCTGTTCCGTCATGCC |