| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072662 |
| Chromosome: | chromosome 6 |
| Location: | 4726264 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279250 | PYM1 | (1 of 1) K14294 - partner of Y14 and mago (WIBG, PYM); Partner of Y14/RBM8A-MAGOH | 3'UTR |
| Cre06.g279300 | (1 of 1) 2.7.10.1//2.7.10.2//2.7.11.1 - Receptor protein-tyrosine kinase / Receptor protein tyrosine kinase // Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTATAATCCTAGCTTCTCTTGTGAACAAGTTGCCCCACGAGCACTTTGT |
| Internal bar code: | ACGTCCCCCCCGGTAACTCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3073 |
| LEAP-Seq percent confirming: | 95.2381 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGCAGTTGGAGGAGCAG |
| Suggested primer 2: | AACAAAGGGTCTGCGAGGAG |