Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.072671 |
Chromosome: | chromosome 9 |
Location: | 6191274 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g413250 | GT90-15,GT90F15 | GT90 family protein 15; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAAGCACGTGAACTGCGCTGTGCGATCCAGTCAGGTCCACCCGCAACCA |
Internal bar code: | GCGGACTAGATTAGGGTTTGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1717 |
LEAP-Seq percent confirming: | 29.6296 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATTCGTTTCCGCAACACT |
Suggested primer 2: | GTGTGTGTGTGTGTGCGTAC |