| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072674 |
| Chromosome: | chromosome 10 |
| Location: | 43875 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g417700 | RPL3 | Cytosolic 80S ribosomal protein L3; (1 of 1) K02925 - large subunit ribosomal protein L3e (RP-L3e, RPL3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGGGGGGACAGCACATGAAGCTGCCAACCCGCGGAATCCAGTTGTT |
| Internal bar code: | ATACCTATTGCGATACGCCCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 330 |
| LEAP-Seq percent confirming: | 32.8571 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGCCTCCTCTTTCCCTTC |
| Suggested primer 2: | TCTGTCTGGTGTCGTCAAGC |