| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072676 |
| Chromosome: | chromosome 17 |
| Location: | 2415220 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g714500 | HTA33,NCG10,HTA1 | Histone H2A; (1 of 30) K11251 - histone H2A (H2A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATTTCATTCCCACTTGCACTCAATCAACAAACTCGGTGTTTCTCAACA |
| Internal bar code: | GACTTGGATGTACAATGTTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3034 |
| LEAP-Seq percent confirming: | 93.617 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGGTGCTCAGGATTGGGT |
| Suggested primer 2: | GAGCGGTTGTTTGACCCAAC |