| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072679 |
| Chromosome: | plastome |
| Location: | 80269 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802297 | psbB,2717002,ChreCp032 | (1 of 1) K02704 - photosystem II CP47 chlorophyll apoprotein (psbB); photosystem II P680 chlorophyll A apoprotein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTATTGCTTCACACCACATCGCAGCTGGTATTTTAGGTGTTTTAGCAGG |
| Internal bar code: | TGGTTGTCACGCTGGACTATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 213 |
| LEAP-Seq percent confirming: | 12.1212 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 87 |
| LEAP-Seq n unique pos: | 99 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGGCATACGACGAACGA |
| Suggested primer 2: | GTTGGGCAGGTTCTATGGCT |