| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072681 |
| Chromosome: | chromosome 6 |
| Location: | 3067889 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g275000 | paralog of LCI36; (1 of 4) K15382 - solute carrier family 50 (sugar transporter) (SLC50A, SWEET) | 3'UTR | |
| Cre06.g275050 | GGH2 | (1 of 2) 3.4.19.9 - Gamma-glutamyl hydrolase / Pteroyl-poly-alpha-glutamate hydrolase; Gamma-glutamyl hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCAAATGTAATGGAGTGCGGCTCGGCAACCCCGGGACGTCACCTCCGC |
| Internal bar code: | ATCACGGGGGCTAAAGCGCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2136 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGTGTGTGTGTTTGTGAT |
| Suggested primer 2: | CTTGCCGTTTGACTTGGTGG |