| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.072697 |
| Chromosome: | chromosome 12 |
| Location: | 2659902 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g505400 | (1 of 1) 3.1.1.47 - 1-alkyl-2-acetylglycerophosphocholine esterase / Platelet-activating factor acetylhydrolase; Related to platelet-activating factor acetylhydrolase | outside_mRNA | |
| Cre12.g505450 | HFO17 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATTTCCCCAGACTCCATTTCCTCGACCCCGACCCCAACCCCTCCCCGG |
| Internal bar code: | ATTCGTGTTTAGCGCCGAAGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3077 |
| LEAP-Seq percent confirming: | 96.7213 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTACCAAGCCCGCTATCCG |
| Suggested primer 2: | AGTGCGTGAGACGACAACAT |