| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.072781 |
| Chromosome: | chromosome 2 |
| Location: | 8527200 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141550 | (1 of 2) 3.4.21.53 - Endopeptidase La / ATP-dependent serine proteinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGCATGGCCTGAGCTCAGCTGACATGGACCGCCCCTGCAACCCCTTG |
| Internal bar code: | GTGTAAGTTTAAGGCGCGTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 485 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTGAGAAGCAGACGTTGA |
| Suggested primer 2: | CGGCTCGACTCATCACTCTC |