Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.072824 |
Chromosome: | chromosome 9 |
Location: | 6459103 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g415200 | NOM1 | nucleolar MIF4G and MA3 domains-containing protein; (1 of 1) K17583 - nucleolar MIF4G domain-containing protein 1 (NOM1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCAAGGCTGGGTAGAAGGAGTGGCTGCCCTGCCGAGTGCCGACTGACC |
Internal bar code: | TACGGTCTGATCTACCTGTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1073 |
LEAP-Seq percent confirming: | 42.1053 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTCCATGCTGCATCATGC |
Suggested primer 2: | GACGTGTGGTTGGACAGCTA |