| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072873 |
| Chromosome: | chromosome 17 |
| Location: | 2447290 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g715000 | HSP33 | Heat shock protein 33; (1 of 1) K04083 - molecular chaperone Hsp33 (hslO) | 3'UTR |
| Cre17.g715050 | RAB28 | Small Rab-related GTPase; (1 of 1) IPR001806//IPR003579//IPR020849//IPR027417 - Small GTPase superfamily // Small GTPase superfamily, Rab type // Small GTPase superfamily, Ras type // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGCTCAGAATCCCCGCGGCTACATGGTACATACTGGTAGCAGCAAAAG |
| Internal bar code: | AATATGGCCTCGGATTCCTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1299 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGTCATACTCACCCGCG |
| Suggested primer 2: | GCTTGTGTGCACACTACAGC |