| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.072883 |
| Chromosome: | chromosome 13 |
| Location: | 1531083 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g572800 | TILS1,TILS | tRNA-Ile Lysidine synthase, organelle; (1 of 1) 6.3.4.19 - tRNA(Ile)-lysidine synthetase / Isoleucine-specific transfer ribonucleate lysidine synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACCGTAATGCGAACACGCATCACTTCCCCAGCCACAGCCTGCTTCGCT |
| Internal bar code: | TTCAGCGGTGCCCGAACTTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1077 |
| LEAP-Seq percent confirming: | 2.5641 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGAGTTGCATGAGCTGGA |
| Suggested primer 2: | CGGTCATGTTGTGTTGCGTT |