| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.072894 |
| Chromosome: | chromosome 11 |
| Location: | 1780751 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467850 | PGA6 | (1 of 2) K13511 - monolysocardiolipin acyltransferase (TAZ); Putative phospholipid/glycerol acyltransferase | outside_mRNA |
| Cre11.g801280 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAAACACAATCCGCCCTGCAGTCACACTGTGTGTGGGGTGAGGCTCCC |
| Internal bar code: | GGATTTGCTTATATATTCGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 149 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGACGTTGGAATGCGATGT |
| Suggested primer 2: | CTTTCACATCCACCCCCTCC |