| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072933 |
| Chromosome: | chromosome 7 |
| Location: | 6422290 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g357750 | (1 of 3) PTHR10383 - SERINE INCORPORATOR | 5'UTR | |
| Cre07.g357800 | CCA1,CCDA1,CCDA | (1 of 1) K06196 - cytochrome c-type biogenesis protein (ccdA); c-type cytochrome biogenesis protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTCAACTGGTCGGACGAGTCTTGGCCTTTCCAAACTGGGCGTCCGCGA |
| Internal bar code: | TCCATCGCCGTTTTTTTGTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1503 |
| LEAP-Seq percent confirming: | 73.8462 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTACCTGCTACCTGCTAC |
| Suggested primer 2: | CGTCCTGTCCCTTCTTTCCC |