| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072961 |
| Chromosome: | chromosome 1 |
| Location: | 5615701 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040100 | (1 of 1) PF13902 - R3H-associated N-terminal domain (R3H-assoc) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGGGGGCCTGACACGGGGGCCTGGTACGTGGCAGGTCCGGGCAGGTG |
| Internal bar code: | GGGTGGGAGTAGTAACCGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 699 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGGCACATTGCGATAACC |
| Suggested primer 2: | TACGCCTAACCCGTCTCTGA |