| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.072968 |
| Chromosome: | plastome |
| Location: | 131830 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802319 | 2717001,ChreCp055,rps11 | 30S ribosomal protein S11; (1 of 1) IPR019981 - Ribosomal protein S11, bacterial-type | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCTTTCATTCTCAGAGAAGATATGTCCATTGAATACTGCCTAAAAAAC |
| Internal bar code: | CAGAATTTACAGTCGCAATGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 49 |
| LEAP-Seq percent confirming: | 10.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCAGAGCTCCAGCATAA |
| Suggested primer 2: | TAGCTGATAGGCGAGGCAAC |