Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.072975 |
Chromosome: | chromosome 3 |
Location: | 9079845 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g201776 | (1 of 1) IPR006575//IPR016135 - RWD domain // Ubiquitin-conjugating enzyme/RWD-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACCGCACCTGCAGCTCTCCTGCCCCTTCCCCCCTACTCGGCCCCCGC |
Internal bar code: | AGTTTTAGTCTACGCAGGCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 475 |
LEAP-Seq percent confirming: | 88.8889 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGGGCTGCCCTAAACATC |
Suggested primer 2: | TAGGAAGTCGAGTGCGGGTA |