| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.072978 |
| Chromosome: | chromosome 8 |
| Location: | 2245137 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g370500 | (1 of 1) IPR013024//IPR017939 - Butirosin biosynthesis, BtrG-like // Gamma-glutamylcyclotransferase | 3'UTR | |
| Cre08.g370550 | (1 of 1) 1.1.99.39 - D-2-hydroxyglutarate dehydrogenase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACTACGCACACAAATAGCCACGCACTCTACATGCATTAGCACATACA |
| Internal bar code: | CCTATGGGCCCACTGAGAACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1723 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGAGCCGTTTAGAGCTAG |
| Suggested primer 2: | AGAAGAAAGGGGAAAGCCGG |