| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.073031 |
| Chromosome: | chromosome 14 |
| Location: | 1603062 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g618500 | (1 of 2) IPR006502//IPR011333//IPR011705 - Protein of unknown function PDDEXK-like // POZ domain // BTB/Kelch-associated | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTCCACTATATCCCATTGCATCTGGCAGGTTCACTTCAACTCACAAC |
| Internal bar code: | TGTGGCAGCGAGTGGGGCCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4034 |
| LEAP-Seq percent confirming: | 98.0392 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTCGTGCCCATGGGTGAAT |
| Suggested primer 2: | GTCTAGTACGGCCTCCATGC |