| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073033 |
| Chromosome: | chromosome 16 |
| Location: | 2839612 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662800 | PRP4 | (1 of 1) K12662 - U4/U6 small nuclear ribonucleoprotein PRP4 (PRPF4, PRP4); Splicing factor, component of the U4/U6-U5 snRNP complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCTCGCCTCCCCCACCCCTGCCCCCACCTGGCAATGGCCATGCGCGCT |
| Internal bar code: | ATTTGGGGTGGCTGCATGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 289 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGTGGTTAAGAAGCCAGG |
| Suggested primer 2: | ACATGATTGGAGTGCAGGGG |